Table 1. A subset of oligonucleotides used to try to attain HU–DNA cocrystals
Base pairsaCrystals
TR35′ TGCTTATCAATTTGTTGCACC17Yes
AHU25′ TGCATATCAATTTGTTGCACC17Yes
AHU35′ TGCAATCAATTTGTTGCACC17No
AHU45′ TGCATACAATTTGTTGCACC17No
AHU55′ TGCAACAATTTGTTGCACC17No
AHU65′ *GCATATCAATTTGTTGCAT17Yes
AHU75′ *GCAATCAATTTGTTGCAT17No
AHU85′ *GCATACAATTTGTTGCAT17No
  • a Number of base pairs in expected duplex.

  • The asterisks indicate 5′ phosphates.

  • T, mismatched in duplex; T, unpaired and flipped; T, unpaired but stacked.