Table 1. Putative Chn target genes containing CBE and/or its variant sequences adjacent to the coding sequence, based on informatics and binding activity
Genes (target sites)Sequence comparisonBindingLocation/direction
(NRSE/RE1)TTCAGCACCACGGACAGCGCC+
 (CBE)BBHASMVMMVCNGACVKNNCC
Neural functions/expressions
 MntGTTACCGACGCCGACGGTACC+1st intron/R
 HMG protein ZCCCACCCCCCCTGACCGACCC+1st intron/R
 allatostatin C receptor2TTTAGCCAAGCCGACAGATCC1st intron/R
 Arrestin 2TGAAGACCCACGGACAGGGCC+0 kb upstream/F
 Olfactory‐specific ETCCACCCCCACCGACGTTCCC+3 kb upstream/R
 DystroglycanCTTAGAACAGCCGACGTCCCC+1st intron/R
 nAcRβ‐64BCGCACCCAAACTGACGGCTCC5′ UTR/F
 LarCGAAGAACAACTGACGTAGCC+4 kb upstream/F
 ether‐a‐go‐goGTCACAGACACAGACCTAGCC+1st intron/R
 Dopamine receptor2CCAAGACAAACAGACGGCCCC+3 kb downstream/F
 kekkon‐2GCCACCCACACCGACATTTCC+5′ coding/F
 shaking BTTAACAGCACCTGACCGACCC+2nd intron/F
 unc‐115TCTACACACCCCGACATGGCC+0 kb upstream/R
 brinkerGCAACAGCAGCAGACATTTCC3′ coding/F
 bifidGGCAGCGACGCTGACGTCGCC+2nd intron/R
 DeformedTGCACCACCGCCGACGGCACC+5′ coding/R
 Socs 16DTCCAGCGAACCGGACGGCTCC5th exon/F
 SalivaTTTAGCAAACCTGACATTGCC3rd intron/R
 hairy (CBE1)CGCAGCAACACAGACCGCCCC+9 kb upstream/F
*hairy (CBE2)GCCACCAAAAAAGACGTAAGT+2nd exon/F
 emc (CBE1)TCCACCAAAGCAGACCTCTCC+5′ UTR/F
*emc (CBE2)CGCACCACCCATGACAGAGCC+3 kb downstream/R
*Dl (CBE1)TTCAGCACCACCGCCATTGGT+2nd intron/F
*Dl (CBE2)CCCAGCCCCACGGCCATATCC+10 kb downstream/F
Oogenesis/cytoskeleton
 spireTGAAGAAAAACCGACATAACC1st intron/F
 orbCCCACAGCAGCCGACCGACCC+1st intron/R
 lkb1TCAACAGAAACGGACAGATCC0.1 kb upstream/R
 Death caspase‐1CGCACCCACACGGACGTACCC+1 kb upstream/R
D/V axis/defence
 TehaoGCAACAAAAACTGACGTCTCC10 kb upstream/F
Cardiac cell development
 tincarCCAACCCAACCTGACCTGACC+7 kb upstream/R
  • (+) Positive binding to Chn zinc‐finger domain, based on EMSA. (−) Very weak binding, if detectable, to Chn zinc‐finger domain. Asterisks represent variant CBE sequences. Black dots indicate positions that differ from the CBE consensus. F and R represent the forward and reverse directions, respectively, against the coding sequences of the candidate target genes. nAcRβ‐64B, nicotinic acetylcholine receptor beta 64B; Socs16D, suppressor of cytokine signaling at 16D; emc, extra macrochaetae; orb, oo18 RNA‐binding protein. Single letter abbreviations: B=C, G or T; H=A, C or T; S=G or C; M=A or C; V=A, C or G; N=A, G, C or T; K=G or T.