Advertisement

Source Data

Transparent Process

Histone H3K9 methyltransferase G9a represses PPARγ expression and adipogenesis

Lifeng Wang, Shiliyang Xu, Ji‐Eun Lee, Anne Baldridge, Sean Grullon, Weiqun Peng, Kai Ge

Author Affiliations

  1. Lifeng Wang1,
  2. Shiliyang Xu1,2,
  3. Ji‐Eun Lee1,
  4. Anne Baldridge1,
  5. Sean Grullon1,2,
  6. Weiqun Peng2 and
  7. Kai Ge*,1
  1. 1 Adipocyte Biology and Gene Regulation Section, Laboratory of Endocrinology and Receptor Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA
  2. 2 Department of Physics, The George Washington University, Washington, DC, USA
  1. *Corresponding author. National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Building 10, Room 8N307, 9000 Rockville Pike, Bethesda, MD 20892, USA. Tel.:+1 301 451 1998; Fax.: +1 301 435 5873; E-mail: kaig{at}niddk.nih.gov
View Full Text

Abstract

PPARγ promotes adipogenesis while Wnt proteins inhibit adipogenesis. However, the mechanisms that control expression of these positive and negative master regulators of adipogenesis remain incompletely understood. By genome‐wide histone methylation profiling in preadipocytes, we find that among gene loci encoding adipogenesis regulators, histone methyltransferase (HMT) G9a‐mediated repressive epigenetic mark H3K9me2 is selectively enriched on the entire PPARγ locus. H3K9me2 and G9a levels decrease during adipogenesis, which correlates inversely with induction of PPARγ. Removal of H3K9me2 by G9a deletion enhances chromatin opening and binding of the early adipogenic transcription factor C/EBPβ to PPARγ promoter, which promotes PPARγ expression. Interestingly, G9a represses PPARγ expression in an HMT activity‐dependent manner but facilitates Wnt10a expression independent of its enzymatic activity. Consistently, deletion of G9a or inhibiting G9a HMT activity promotes adipogenesis. Finally, deletion of G9a in mouse adipose tissues increases adipogenic gene expression and tissue weight. Thus, by inhibiting PPARγ expression and facilitating Wnt10a expression, G9a represses adipogenesis.

There is a Have you seen? (January 2013) associated with this Article.

Introduction

Peroxisome proliferator‐activated receptor γ (PPARγ) is a member of the nuclear receptor superfamily of ligand‐activated transcription factors. PPARγ is considered as the master positive regulator of preadipocyte differentiation towards adipocyte (adipogenesis) and is both necessary and sufficient for adipogenesis (Rosen and Spiegelman, 2001; Farmer, 2006; Rosen and MacDougald, 2006). PPARγ has two isoforms, PPARγ1 and PPARγ2, which are produced by differential promoter usage and alternative splicing. PPARγ1 is expressed at low level in preadipocytes where PPARγ2 is undetectable. Both isoforms are strongly induced during adipogenesis (Rosen and MacDougald, 2006). PPARγ expression is positively regulated by a cascade of sequentially expressed adipogenic transcription factors. Expression of early adipogenic transcription factors C/EBPβ, C/EBPδ, Krox20, and KLF4 is induced within hours of initiation of adipogenesis (Farmer, 2006; Birsoy et al, 2008; Ge, 2012). C/EBPβ directly binds to −0.3 kb of PPARγ2 promoter and activates PPARγ2 expression (Salma et al, 2006). C/EBPβ and C/EBPδ also activate expression of another principal adipogenic transcription factor C/EBPα. PPARγ cooperates with C/EBPα in a positive feedback loop to promote terminal differentiation of adipocytes (Farmer, 2006; Rosen and MacDougald, 2006).

The Wnt family of secreted proteins is important developmental regulators. The canonical Wnt signalling, also known as Wnt/β‐catenin signalling, is a major negative regulator of adipogenesis (Prestwich and Macdougald, 2007). Among the 19 Wnt family members in mice and humans, Wnt1, Wnt6, Wnt10a, and Wnt10b have been shown to inhibit adipogenesis. Expression of endogenous Wnt6, Wnt10a, and Wnt10b decreases during adipogenesis. Activation of Wnt/β‐catenin signalling by overexpression of Wnt1, Wnt6, Wnt10a, and Wnt10b prevents the induction of PPARγ and C/EBPα and inhibits adipogenesis through a β‐catenin‐dependent mechanism (Cawthorn et al, 2012). Conversely, inhibiting the Wnt/β‐catenin signalling promotes adipogenesis (Ross et al, 2000). In mice, Wnt1 and Wnt10b genes are clustered on chromosome 15 while Wnt6 and Wnt10a genes are clustered on chromosome 1 in a head‐to‐tail manner.

Epigenetic mechanisms in particular histone modifications play important roles in regulating gene expression and cell differentiation. Histone acetylation on lysine (K) residues generally correlates well with gene activation. However, histone methylation on K residues can be correlated with either gene activation or repression, depending on which K residue gets methylated. Genome‐wide analyses have revealed that trimethylation on histone 3 lysine 4 (H3K4me3) is enriched on active gene promoters, while trimethylation on histone 3 lysine 27 (H3K27me3) is enriched on repressed genes (Boyer et al, 2006; Barski et al, 2007; Mikkelsen et al, 2007). Histone H3 lysine 9 dimethylation (H3K9me2) is enriched in silent regions on euchromatin and correlates with gene silencing (Rice et al, 2003; Barski et al, 2007). Histone methyltransferase (HMT) G9a mainly functions on euchromatin and is responsible for the majority of H3K9me2 in cells (Tachibana et al, 2002; Rice et al, 2003). Studies using G9a knockout (KO) or knockdown cells and mice suggest that G9a and G9a‐mediated H3K9me2 mainly associate with transcriptional silencing (Shinkai and Tachibana, 2011). Interestingly, recent reports also show that G9a is involved in activation of specific genes in an HMT activity‐independent manner (Lee et al, 2006; Chaturvedi et al, 2009). Thus, G9a plays a dual role in regulating gene expression.

Previous reports suggest that H3K4me3 positively regulates PPARγ expression while H3K27me3 negatively regulates Wnt expression during adipogenesis (Cho et al, 2009; Mikkelsen et al, 2010; Wang et al, 2010; Ge, 2012). However, the mechanisms that negatively regulate PPARγ expression while positively regulate Wnt expression during adipogenesis remain incompletely understood. Further, the roles of G9a and G9a‐mediated H3K9me2 in adipogenesis have not been shown. In this paper, we report genome‐wide profiling of H3K9me2 in preadipocytes. At the genome‐wide level, H3K9me2 correlates inversely with both H3K4me3 and H3K27me3. Among gene loci encoding adipogenesis regulators, H3K9me2 is selectively enriched on the entire PPARγ locus, where H3K27me3 is absent. We show that G9a represses PPARγ expression by adding H3K9me2 to the entire PPARγ gene locus and that G9a facilitates Wnt10a expression independent of its enzymatic activity. Finally, deletion of G9a promotes adipogenesis in cell culture and increases adipose tissue weight in mice.

Results

H3K9me2 is enriched on the entire PPARγ locus in preadipocytes

To investigate the roles of site‐specific histone methylations in adipogenesis, we performed chromatin immunoprecipitation followed by deep sequencing (ChIP‐Seq) of H3K4me3, H3K9me2, and H3K27me3 in undifferentiated 3T3‐L1 white preadipocytes. The H3K4me3 and H3K27me3 ChIP‐Seq results were highly consistent with the reported genome‐wide profiling data using the same cell line (Mikkelsen et al, 2010). Unlike H3K4me3 and H3K27me3, both of which peaked around the transcription start sites (TSSs), H3K9me2 level was generally low around the TSSs and in the gene body regions but was enriched in upstream and downstream untranscribed regions (Figure 1A). At the genome‐wide level, we observed mutually exclusive occupancies between the repressive mark H3K9me2 and the active marks including H3K4me3 (Figure 1B), H3K27ac, and H3K36me3 (Supplementary Figure S1A). Interestingly, H3K9me2 also correlated inversely with H3K27me3 globally (Figure 1C), suggesting that the two repressive epigenetic marks target distinct sets of genes in preadipocytes. Consistent with the association of H3K9me2 with gene repression, gene expression levels correlated inversely with H3K9me2 intensities at genome‐wide level (Figure 1D). Gene ontology (GO) analysis of H3K9me2‐enriched genes identified the immune and inflammatory response genes (Supplementary Figure S1B), which have been shown to be directly regulated by G9a and H3K9me2 (Fang et al, 2012).

Figure 1.

H3K9me2 is enriched on the entire PPARγ locus in preadipocytes. ChIP‐Seq analyses of histone methylations were done in 3T3‐L1 preadipocytes with the sequence read length of 50 bp. (A) Positional distribution profiles of global H3K4me3, H3K9me2 and H3K27me3 around gene body±5 kb regions in 3T3‐L1 preadipocytes. TSS, transcription start site; TES, transcription end site. The numbers between TSS and TES indicate the sites (percentage) of gene body. (B, C) Inverse correlation of global H3K9me2 levels with H3K4me3 and H3K27me3 levels in promoter and gene body regions. The horizontal line indicates the mean level of H3K9me2 enrichment and the vertical bar indicates the spread variations (root mean square (RMS)). RPKM, reads per kb per million read sequenced. (D) Inverse correlation of H3K9me2 level with gene expression. The horizontal line indicates the mean level of H3K9me2 enrichment and the vertical bar indicates the spread variations (RMS). The gene expression levels in 3T3‐L1 preadipocytes were analysed by RNA‐Seq. (E, F) Profiles of H3K4me3 (green), H3K9me2 (blue) and H3K27me3 (red) on PPARγ and Wnt6Wnt10a loci are visualized using the UCSC genome browser. (G) ChIP analyses of histone methylations on promoters of positive and negative regulators of adipogenesis in 3T3‐L1 preadipocytes. Profiles of H3K4me3, H3K9me2 and H3K27me3 on the entire gene loci of these adipogenesis regulators are shown in Figure 2. The locations of quantitative PCR (qPCR) primers for ChIP are PPARγ1 (+0.5 kb), PPARγ2 (+0.5 kb), C/EBPα (+0.3 kb), C/EBPβ (+0.3 kb), C/EBPδ (+0.2 kb), Krox20 (+0.5 kb), KLF4 (+0.3 kb), CREB (+0.2 kb), Wnt6 (+0.5 kb), Wnt10a (+0.8 kb) and GAPDH (+0.8 kb) (also see Supplementary Tables S2 and S3). Data are representative of three independent experiments. qPCR data in all figures are presented as mean values±s.d.

We next examined H3K9me2 levels on gene loci encoding known positive and negative regulators of adipogenesis (Farmer, 2006; Rosen and MacDougald, 2006). High levels of H3K9me2 were found on the entire 129 kb gene locus of the master adipogenic transcription factor PPARγ (Figure 1E). In contrast, H3K9me2 levels were low on gene loci encoding other adipogenic transcription factors, including C/EBPα, C/EBPβ, C/EBPδ, KLF4, Krox20 and CREB (Figure 2A–G). Interestingly, H3K9me2 levels were also low on gene loci encoding negative regulators of adipogenesis, including Wnt6‐Wnt10a, Wnt1‐Wnt10b, Pref‐1 (also known as DLK1), GATA2, GATA3, KLF2 and Chop10 (Figures 1F and 2H–N). The selective enrichment of H3K9me2 on PPARγ locus in preadipocytes was confirmed by manual ChIP (Figure 1G). PPARγ is expressed at low level in preadipocytes. Accordingly, H3K27ac and H3K36me3 levels were low on the PPARγ locus in preadipocytes (Supplementary Figure S1C and D). ChIP‐Seq data confirmed our previous observation that H3K27me3 was enriched on the Wnt loci (Figures 1F, 2H and I; Wang et al, 2010). Consistent with a previous report (Mikkelsen et al, 2010), H3K27me3 was excluded from the PPARγ locus where H3K9me2 was enriched (Figure 1E), suggesting that H3K9me2, rather than H3K27me3, is involved in repressing PPARγ expression in preadipocytes.

Figure 2.

Histone methylation profiles on adipogenesis regulator genes in preadipocytes. ChIP‐Seq profiles of H3K4me3, H3K9me2 and H3K27me3 on gene loci encoding positive (AG) and negative (HN) regulators of adipogenesis in 3T3‐L1 preadipocytes (day 0) are visualized using the UCSC genome browser. Panels (A) and (H) are shown as controls.

H3K9me2 and G9a levels decrease during adipogenesis

We next examined histone methylation changes on the PPARγ locus before and after adipogenesis by ChIP assay. Consistent with previous reports (Cho et al, 2009; Mikkelsen et al, 2010; Wang et al, 2010), H3K4me3 levels on PPARγ1 and γ2 promoters increased after differentiation of 3T3‐L1 white preadipocytes (Figure 3A), which correlated well with both the induction and the relative expression levels of PPARγ1 and γ2 (Figure 3D). H3K27me3 remained very low on PPARγ locus but remained high on Wnt10a locus throughout adipogenesis (Figure 3A). Interestingly, H3K9me2 levels on the entire PPARγ locus decreased markedly, which was confirmed by ChIP‐Seq of H3K9me2 before and after adipogenesis of 3T3‐L1 cells (Figure 3A and B). The decrease in H3K9me2 levels on PPARγ locus correlated inversely with the marked induction of PPARγ during adipogenesis. G9a expression levels also decreased during adipogenesis, mainly at the protein level (Figure 3C and D). Accordingly, global H3K9me2 level decreased during 3T3‐L1 adipogenesis (Figure 3D). Similar results were obtained during adipogenesis of brown preadipocytes (Supplementary Figure S2). Consistent with the results from 3T3‐L1 adipogenesis in cell culture, G9a protein level was much lower in adipocytes than in preadipocytes of white adipose tissue (WAT) (Figure 3E). The global as well as PPARγ locus‐specific decreases in H3K9me2 suggest that G9a and H3K9me2 negatively regulate PPARγ expression and adipogenesis.

Figure 3.

H3K9me2 and G9a levels decrease during adipogenesis. (A) ChIP analyses of H3K4me3, H3K9me2 and H3K27me3 on PPARγ1 and PPARγ2 promoters before (day 0) and after (day 6) 3T3‐L1 adipogenesis. The schematic of PPARγ1 and PPARγ2 promoters and the locations of Taqman probes for PCR quantitation of ChIP are shown at the top. Wnt10a promoter serves as a control. (B) ChIP‐Seq profiles of H3K9me2 on PPARγ locus (highlighted) before (day 0) and after (day 7) 3T3‐L1 adipogenesis. (C) qRT–PCR analysis of PPARγ and G9a expression before and after 3T3‐L1 adipogenesis. (D) Western blot analysis of G9a, PPARγ and H3K9me2 levels during 3T3‐L1 adipogenesis. The 54.5‐kDa PPARγ1 and 57.5‐kDa PPARγ2 bands as well as the 30‐kDa and 42‐kDa C/EBPα isoforms are indicated. The p85α subunit of phosphoinositol‐3‐phosphate kinase is used as a loading control. (E) Western blot analysis of protein levels in preadipocytes and adipocytes isolated from mouse inguinal white adipose tissue.Source data for this figure is available on the online supplementary information page.

Characterization of SV40T‐immortalized G9a−/− preadipocytes

G9a is required for cell growth as knockdown of G9a in cells leads to senescence (Takahashi et al, 2012). Deletion of G9a in primary mouse embryonic fibroblasts (MEFs) and primary white preadipocytes also led to severe growth defect and senescence due to derepression of tumor suppressor genes such as p16Ink4a (Supplementary Figure S3). To investigate the role of G9a in adipogenesis and also to distinguish the roles of G9a in cell differentiation versus proliferation, we immortalized primary G9aflox/flox brown preadipocytes with SV40 large T antigen (SV40T) following an established protocol (Wang et al, 2010). SV40T functionally inactivates p16Ink4a but does not interfere with differentiation of brown preadipocytes (Wang et al, 2010). The immortalized cells were infected with retrovirus expressing Cre to generate G9a−/− brown preadipocytes (Figure 4A and B). Unlike the case of primary preadipocytes, deletion of G9a had no significant effects on the morphology or the growth rate of the immortalized cells (Figure 4C and D). Consistent with previous reports on G9a−/− embryonic stem (ES) cells (Peters et al, 2003), G9a−/− brown preadipocytes showed marked reduction of H3K9me1 and H3K9me2 but retained robust H3K9me3. Among the histone methylation and acetylation marks that we examined, H3K9 acetylation (H3K9ac) increased markedly in G9a−/− preadipocytes (Figure 4E). The decrease of H3K9me2 and the increase of H3K9ac in G9a−/− cells could be reversed by ectopic expression of G9a (Supplementary Figure S4A).

Figure 4.

Characterization of immortalized G9aflox/flox brown preadipocytes. SV40T‐immortalized G9aflox/flox brown preadipocyte cell line #1 was infected with retroviruses MSCVhygro expressing Cre (MSCVhygro‐Cre) or vector (Vec) alone. After selection with 150 μg/ml hygromycin for 2 weeks, cells were maintained at subconfluence. (A, B) Confirmation of G9a deletion by qRT–PCR (A) and western blot (B). (C) Cell morphology under the microscope. (D) To analyse the short‐term cell growth rates, 1 × 105 cells were plated at day 0 and the cumulative cell numbers were determined every day for 5 days. (E) Western blot analysis of histone methylation and acetylation in nuclear extracts. me1, me2 and me3 refer to mono‐, di‐ and trimethylation, respectively. ac, acetylation.Source data for this figure is available on the online supplementary information page.

G9a represses adipogenesis

Among the three SV40T‐immortalized G9aflox/flox brown preadipocyte cell lines that we established, #1 cell line showed poor differentiation potential, with ∼40% of cells in the population differentiating into relatively immature adipocytes under the standard induction condition. However, deletion of G9a in the #1 cell line accelerated and enhanced adipogenesis, with over 90% of cells in the population differentiating into lipid‐laden adipocytes (Figure 5A). The markedly enhanced adipogenesis could be reversed by ectopic expression of G9a (Supplementary Figure S4B). Consistent with the morphological differentiation, deletion of G9a in the #1 cell line promoted induction of master adipogenic transcription factors PPARγ and C/EBPα and increased expression of other adipocyte markers such as aP2, PGC1α, Prdm16, UCP1 and adiponectin (Figure 5B and C; Supplementary Figure S4C). The other two immortalized G9aflox/flox brown preadipocyte cell lines (#2 and #3) showed full adipogenesis potential under the standard induction condition (Supplementary Figure S4D). However, enhanced adipogenesis was also observed in #2 and #3 G9a−/− brown preadipocyte cell lines when differentiation was induced under suboptimal condition (Supplementary Figure S4E). Consistently, in 3T3‐L1 white preadipocytes, knockdown of G9a decreased global H3K9me2 level and promoted PPARγ expression and adipogenesis (Figure 5D–G), while overexpression of G9a inhibited adipogenesis (Figure 5H and I). These results indicate that G9a represses adipogenesis in both white and brown preadipocytes.

Figure 5.

G9a represses adipogenesis. (AC) G9a represses adipogenesis of brown preadipocytes. G9aflox/flox brown preadipocytes described in Figure 4 were infected with MSCVhygro‐Cre. Adipogenesis was induced at standard condition at day 0. Whole cell extracts and RNA samples were prepared at indicated time points for western blot and qRT–PCR, respectively. (A) Morphological differentiation at day 6. Cells were stained with Oil Red O. Top panels, stained dishes; lower panels, representative fields under the microscope. (B) Western blot analysis of expression of adipogenesis makers and G9a during adipogenesis. (C) qRT–PCR analysis of expression of adipogenic makers and G9a during adipogenesis. (DG) Knockdown of G9a promotes adipogenesis of 3T3‐L1 white preadipocytes. 3T3‐L1 cells were infected with lentiviral shRNA targeting G9a or control (Con), followed by puromycin selection for 7 days. (D) Western blot analysis of undifferentiated, subconfluent cells using antibodies indicated on the right. (E) qRT–PCR analysis of G9a and PPARγ expression in undifferentiated, subconfluent 3T3‐L1 cells. (F, G) Adipogenesis was induced at suboptimal condition using 1/3 of adipogenic cocktail. After differentiation, cells were stained with Oil Red O (F) or collected for qRT–PCR analysis of adipocyte marker expression (G). (H, I) Overexpression of G9a inhibits 3T3‐L1 adipogenesis. Cells were infected with MSCVhygro expressing FLAG‐tagged G9a (F‐G9a). Adipogenesis was induced at standard condition. (H) Oil Red O staining after differentiation. (I) qRT–PCR analysis of adipocyte marker expression before and after adipogenesis.Source data for this figure is available on the online supplementary information page.

G9a directly represses PPARγ expression but facilitates Wnt10a expression

The enrichment of G9a‐mediated H3K9me2 on PPARγ locus and the accelerated PPARγ induction during adipogenesis of G9a−/− cells suggest that G9a may directly repress PPARγ expression. Indeed, microarray analysis followed by qRT–PCR confirmation showed that deletion of G9a in preadipocytes increased basal level PPARγ expression but had little effects on basal level expression of other positive regulators of adipogenesis including C/EBPα, C/EBPβ, C/EBPδ, Krox20, KLF4, SREBP1, STAT5A, CREB and GR (Supplementary Figures S5A, B and 6A). G9a was enriched on both PPARγ1 and γ2 promoters in preadipocytes. Deletion of G9a decreased H3K9me2 level but increased levels of RNA polymerase II (Pol II) and H3K9ac on PPARγ1 and γ2 promoters (Figure 6B). The increased PPARγ level in G9a−/− preadipocytes could be reversed by ectopic expression of wild‐type G9a but not the enzyme‐dead mutant ΔSET (Figure 6C; Supplementary Figure S5B). Using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements) analysis to monitor chromatin opening (Simon et al, 2012), we observed moderately increased chromatin opening on PPARγ1 promoter in G9a−/− preadipocytes (Figure 6D).

Figure 6.

G9a directly represses PPARγ expression but facilitates Wnt10a expression. G9aflox/flox brown preadipocytes described in Figure 4 were infected with MSCVhygro‐Cre. (A, B) G9a directly represses PPARγ expression in preadipocytes. Cells maintained at subconfluence were collected for (A) qRT–PCR analysis of expression of adipogenic transcription factors and (B) ChIP assays of G9a, H3K9me2, H3K9ac and RNA polymerase II (Pol II) levels on PPARγ1/γ2 promoters (+0.5 kb). (C) G9a enzymatic activity is required for repressing PPARγ expression in preadipocytes. G9aflox/flox brown preadipocytes were infected with MSCVhygro‐F‐G9a expressing FLAG‐tagged G9a (F‐G9a) or with MSCVhygro‐F‐G9aΔSET expressing G9a lacking the SET domain. After hygromycin selection, cells were infected with WZLneo expressing Cre (WZLneo‐Cre), followed by selection with G418. Gene expression in subconfluent preadipocytes was analysed by qRT–PCR. (D) FAIRE analysis of chromatin opening on PPARγ1 promoter. (EG) Deletion of G9a promotes chromatin opening of, and C/EBPβ binding to, PPARγ2 promoter in the early phase of adipogenesis. Adipogenesis of Vec‐ and Cre‐infected G9aflox/flox brown preadipocytes was induced under standard condition. Samples were collected at indicated time points for qRT–PCR of PPARγ2 and C/EBPβ expression (E), ChIP of C/EBPβ and H3K9me2 around −0.3 kb C/EBPβ‐binding site on PPARγ2 promoter (F), and FAIRE analysis of chromatin opening on PPARγ2 promoter (G). (H) Wnt10a expression in preadipocytes requires G9a. Cells maintained at subconfluence were collected for qRT–PCR. (I) Western blot analysis of β‐catenin levels in the cytosolic and membrane fractions. β‐Actin serves as the loading control. (J) G9a facilitates Wnt10a expression in preadipocytes independent of its enzymatic activity. The experiment was done as in (C). (K) ChIP of G9a and Pol II levels on Wnt10a promoter in subconfluent preadipocytes. qPCR data are presented as means±s.d. and are representative of 3–4 independent experiments.Source data for this figure is available on the online supplementary information page.

The increased PPARγ expression in G9a−/− preadipocytes mainly came from PPARγ1, as PPARγ2 level was very low before differentiation. However, deletion of G9a and thus the removal of H3K9me2 significantly enhanced PPARγ2 induction in the early phase of adipogenesis (Figure 6E). C/EBPβ directly binds to −0.3 kb of PPARγ2 promoter and stimulates PPARγ2 expression in the early phase of adipogenesis (Salma et al, 2006; Nielsen et al, 2008). Deletion of G9a had no effect on C/EBPβ induction but promoted C/EBPβ binding to −0.3 kb of PPARγ2 promoter in the early phase of adipogenesis (Figure 6E and F). C/EBPβ binding has been shown to correlate with, and be required for, the efficient opening of chromatin region surrounding the C/EBPβ‐binding site on PPARγ2 promoter (Siersbaek et al, 2011). By FAIRE analysis, we observed increased opening of chromatin region surrounding the −0.3 kb C/EBPβ‐binding site on PPARγ2 promoter in G9a−/− cells 2 h after induction of differentiation, which remained open in the early phase of adipogenesis (Figure 6G). These results suggest that elimination of H3K9me2 by G9a deletion promotes chromatin opening and binding of C/EBPβ, which directly activates PPARγ2 expression.

Multiple negative regulators of adipogenesis have also been described, including Wnt1, Wnt6, Wnt10a, Wnt10b, Pref‐1, GATA2, GATA3, KLF2 and Chop10 (Rosen and MacDougald, 2006). Among them, Wnt10a expression decreased markedly and expression of Wnt1 and Wnt6 decreased about two‐fold in G9a−/− preadipocytes (Figure 6H; Supplementary Figure S5A and B). Consistent with the decreased expression of Wnt genes, the cytosolic β‐catenin level also decreased in G9a−/− preadipocytes (Figure 6I), indicating attenuated Wnt signalling with G9a deletion. Interestingly, the decreased expression of Wnt10a in G9a−/− preadipocytes could be rescued by ectopic expression of both wild‐type G9a and the enzyme‐dead mutant ΔSET (Figure 6J; Supplementary Figure S5B), indicating that G9a facilitates Wnt10a expression in preadipocytes independent of its enzymatic activity. Consistently, ChIP assays revealed recruitment of G9a and G9a‐dependent recruitment of Pol II to Wnt10a promoter where H3K9me2 level was absent (Figures 6K and 1F). Compared to the wild‐type G9a, the enzyme‐dead mutant ΔSET showed reduced ability to repress adipogenesis in G9a KO preadipocytes, suggesting that the HMT activity of G9a is critical for repressing adipogenesis (Supplementary Figure S5C). Together, these results indicate that G9a directly represses PPARγ expression through H3K9me2 while facilitates Wnt10a expression independent of its methyltransferase activity.

Inhibiting G9a methyltransferase activity promotes PPARγ expression and adipogenesis

To confirm the role of G9a methyltransferase activity in repressing PPARγ expression and adipogenesis, we treated preadipocytes with G9a inhibitor BIX01294 (BIX) (Kubicek et al, 2007). To minimize the potential toxicity to cells, confluent preadipocytes were treated with 8 μM BIX for 48 h before the induction of adipogenesis. BIX treatment decreased H3K9me2 levels but increased H3K9ac levels not only globally but also on PPARγ1 and γ2 promoters in preadipocytes (Figure 7A and B). BIX treatment increased PPARγ expression in preadipocytes but did not affect Wnt10a expression (Figure 7C), indicating that G9a represses PPARγ expression through H3K9me2 while facilitates Wnt10a expression independent of its enzymatic activity. Further, treating preadipocytes with BIX for 48 h before the induction of differentiation promoted adipogenesis and expression of adipocyte markers PPARγ, C/EBPα and aP2, although not as much as G9a deletion (Figure 7D and E). These results indicate that H3K9 methyltransferase activity of G9a is required for repressing PPARγ and adipogenesis.

Figure 7.

Inhibiting G9a methyltransferase activity promotes PPARγ expression and adipogenesis. G9aflox/flox brown preadipocytes described in Figure 4 were infected with MSCVhygro‐Cre or Vec alone, followed by BIX treatment and adipogenesis assay. In all, 8 μM of BIX was used except as indicated in (A). (AC) Inhibiting G9a methyltransferase activity promotes PPARγ expression in preadipocytes. BIX was added when cells reached confluence. Forty‐eight hours later, cells were collected for western blot of H3K9me2 and H3K9ac (A), ChIP of H3K9me2 and H3K9ac levels on PPARγ1/γ2 promoters at +0.5 kb (B), and qRT–PCR of PPARγ and Wnt10a expression (C). (D, E) Inhibiting G9a methyltransferase activity promotes adipogenesis. BIX was added when cells reached confluence. Forty‐eight hours later, BIX was removed and adipogenesis was induced under standard condition. Six days later, cells were stained with Oil Red O (D) or collected for qRT–PCR of adipocyte marker expression (E). qPCR data are presented as means±s.d. and are representative of three independent experiments.Source data for this figure is available on the online supplementary information page.

Deletion of G9a increases adipose tissue weight in mice

G9a is essential for early embryogenesis (Tachibana et al, 2002). To investigate G9a function in adipose tissue in vivo, adipose‐specific G9a KO mice were generated by crossing G9aflox/flox with aP2‐Cre mice expressing Cre under the control of adipocyte‐specific aP2 promoter (He et al, 2003; Li et al, 2011). aP2 is a direct PPARγ target gene and is robustly induced when preadipocytes (such as 3T3‐L1) have differentiated into immature adipocytes (Cho et al, 2009).

Analyses of the time courses of aP2 expression during adipogenesis of primary white preadipocytes, 3T3‐L1, and immortalized brown preadipocytes revealed that aP2 was induced at days 1–2, well before PPARγ expression reached the maximal level (Supplementary Figure S6). Thus, aP2 promoterdriven Cre was expected to start deleting G9a in immature adipocytes before the completion of adipogenesis. To confirm this, we performed ex vivo experiments. As shown in Figure 8A and B, primary white preadipocytes directly isolated from G9a KO (G9aflox/flox;aP2‐Cre) mice showed enhanced adipogenesis and increased expression of adipogenesis marker genes than the littermate controls (G9aflox/flox). Further, genomic PCR revealed that aP2‐Cre‐mediated deletion of G9a allele in G9aflox/flox;aP2‐Cre preadipocytes started from day 2 of adipogenesis (Figure 8C). These results indicate that aP2‐Cre‐mediated deletion of G9a promotes adipogenesis and PPARγ expression.

Figure 8.

aP2‐Cre‐mediated deletion of G9a promotes adipogenesis ex vivo. Primary white preadipocytes were isolated from inguinal white adipose tissues of littermate control (Con, with the genotype G9aflox/flox) and G9a knockout mice (KO, with the genotype G9aflox/flox;aP2‐Cre). (A) Adipogenesis assay. (B) qRT–PCR of gene expression during adipogenesis. (C) aP2‐Cre‐mediated deletion of G9a allele was determined by quantitative PCR analysis of tissue genomic DNA. qPCR was performed in triplicates for littermate group 1. Similar results were obtained for littermate groups 2 and 3 (data not shown). qPCR data are presented as means±s.e.m.

In the adipose‐specific G9a KO mice, deletion of G9a allele was found in epididymal and inguinal WATs and interscapular brown adipose tissue (BAT) but not in other tissues examined (Supplementary Figure S7A). Under normal chow, adipose‐specific G9a KO mice weighed more than the littermate controls starting from 12 weeks age (Figure 9A and B; Supplementary Figure S7B). Body composition test showed increases in fat mass but not lean mass in G9a KO mice compared to the controls (Figure 9C). Consistently, G9a KO mice showed increases in size and weight of both WAT and BAT but not other tissues (Figure 9D and E; Supplementary Figure S7C). Histology analyses of adipose tissue sections revealed increased size of adipocytes in G9a KO mice, suggesting enhanced adipose tissue development in vivo (Figure 9F and G). Serum chemistry analyses showed that G9a KO mice had statistically higher levels of triglyceride, total cholesterol, insulin and leptin in blood (Supplementary Table S1). Consistently, fatty liver was found in a high percentage of male G9a KO mice although no G9a deletion was detected in liver (Supplementary Figure S7D). G9a KO mice showed the trend of increased food intake compared with the littermate controls (Supplementary Figure S7E). Expression of adipogenic markers PPARγ, C/EBPα and aP2 increased significantly in G9a KO mice while Wnt10a expression decreased (Figure 9H). Moderately increased expression of adipogenic marker genes was also observed in the BATs isolated from G9a KO newborn pups, suggesting enhanced adipogenesis (Supplementary Figure S7F). These results are consistent with the increased adipogenesis in G9a KO preadipocytes in vitro and ex vivo and indicate that deletion of G9a in mouse adipose tissue promotes adipogenic gene expression and increases fat accumulation and tissue weight.

Figure 9.

Deletion of G9a increases adipose tissue weight in mice. Adipose‐specific G9a knockout (KO) mice carried the genotype of G9aflox/flox;aP2‐Cre. Other age‐matched littermates were used as control (Con) (see Materials and methods). All data were from 16‐ to 22‐week‐old male mice. Female mice data are shown in Supplementary Figure S7B and C. (A) Representative pictures of Con and KO mice. (B) Growth curves of Con (n=10) and KO (n=7) mice fed with normal chow. (C) Increased fat mass in KO mice. Body composition was measured in non‐anaesthetized mice using the Bruker Minispec NMR analyzer. (DG) Increased adipose tissue weights and adipocyte sizes in KO mice. (D) Representative pictures of epididymal WAT (epi‐WAT), inguinal WAT (ing‐WAT) and interscapular BAT isolated from Con and KO mice. (E) The average tissue weights in Con (n=8) and KO (n=6) mice are presented as % of body weight. (F, G) H&E staining of paraffin sections of ing‐WAT from Con and KO mice are shown in (F). The cell sizes in the sections were quantified with ImageJ (G). (H) qRT–PCR analysis of gene expression in ing‐WAT of Con (n=8) and KO (n=8) mice. (I) Model on how G9a represses adipogenesis. G9a inhibits PPARγ expression by adding H3K9me2 on the entire PPARγ locus while facilitates Wnt10a expression independent of HMT activity. All values are presented as the mean±s.e.m. *P<0.05; **P<0.01; ***P<0.005. Similar results were obtained from male and female mice, but only the male mice data are shown here.

Discussion

PPARγ is the master adipogenic transcription factor while Wnt proteins are major negative regulators of adipogenesis. Using ChIP‐Seq, we show that among gene loci encoding major adipogenesis regulators, G9a‐mediated repressive epigenetic mark H3K9me2 is selectively enriched on the entire PPARγ gene locus. G9a and H3K9me2 decrease both globally as well as on the PPARγ locus during adipogenesis. Deletion of G9a or inhibiting its enzymatic activity removes H3K9me2 and promotes both basal level expression and induction of PPARγ. On the other hand, G9a facilitates Wnt10a expression in preadipocytes independent of its enzymatic activity. Deletion of G9a in mouse adipose tissues increases PPARγ expression but decreases Wnt10a expression. Consistently, deletion of G9a or inhibiting its enzymatic activity promotes adipogenesis. These results suggest a model that by inhibiting PPARγ expression through H3K9me2 while promoting Wnt10a expression independent of its methyltransferase activity, G9a represses adipogenesis (Figure 9I).

Profile of H3K9me2 in preadipocytes

G9a‐mediated H3K9me2 covers the entire 129 kb PPARγ gene locus in preadipocytes, which is consistent with the observations in ES cells that G9a‐mediated H3K9me2 covers large chromatin regions (Wen et al, 2009; Lienert et al, 2011). Different from the active epigenetic mark H3K4me3 which is enriched around TSSs and associates with active genes during adipogenesis (Mikkelsen et al, 2010; Ge, 2012), H3K9me2 is generally excluded from active genes and is mutually exclusive with H3K4me3. Consistent with the established role of H3K9me2 in gene repression and with the results from ES cells (Lienert et al, 2011), H3K9me2 correlates inversely with gene expression levels in preadipocytes. Genes carrying high levels of H3K9me2 are expressed at very low levels, an observation also seen in ES cells (Wen et al, 2009). On the other hand, genes carrying low levels of H3K9me2 show varying levels of expression, suggesting that loss of the repressive H3K9me2 alone is insufficient for gene activation and that transcription activators and/or active histone marks are needed for gene activation.

We observe an inverse correlation between H3K9me2 and H3K27me3 at genome‐wide scale in preadipocytes, similar to the observation in ES cells (Lienert et al, 2011). H3K9me2 level is high on PPARγ locus but very low on Wnt6‐Wnt10a locus. In contrast, H3K27me3 level is absent on PPARγ locus but high on Wnt6‐Wnt10a locus (Figure 1E and F). Consistently, removal of H3K9me2 by inhibiting G9a methyltransferase activity in preadipocytes de‐represses PPARγ expression but has no effect on Wnt10a expression (Figure 7C); removal of H3K27me3 by deletion of H3K27 methyltransferase Ezh2 de‐represses Wnt genes but has no effect on PPARγ expression in preadipocytes (Wang et al, 2010). These results suggest that although both H3K9me2 and H3K27me3 associate with gene repression, they silence distinct sets of target genes in preadipocytes. Consistently, despite the loss of H3K9me2 during adipogenesis, H3K27me3 level remains low on the PPARγ locus (Figure 3A).

Interestingly, removal of H3K9me2 by G9a deletion leads to marked upregulation of H3K9ac both globally and on PPARγ promoter (Figures 4E and 6B). We have shown previously that H3K9ac correlates well with, but is dispensable for, nuclear receptor target gene expression, suggesting that H3K9ac is a consequence, rather than a cause, of gene activation (Jin et al, 2011). Whether the increased H3K9ac in G9a−/− cells promotes PPARγ expression or is simply a marker for the active PPARγ promoter remains to be investigated.

Selective enrichment of H3K9me2 on PPARγ locus in preadipocytes

Among gene loci encoding the major positive and negative regulators of adipogenesis, G9a‐mediated H3K9me2 is selectively enriched on the PPARγ locus in preadipocytes, suggesting a rather specific role of G9a‐mediated H3K9me2 in repressing PPARγ expression. PPARγ is a direct target of G9a and deletion of G9a in preadipocytes increases expression of PPARγ but not other positive regulators of adipogenesis (Figure 6A and B). Consistently, inhibiting G9a activity decreased H3K9me2 level on PPARγ locus and increased PPARγ expression in preadipocytes. Future studies will be needed to identify the mechanism that targets G9a to PPARγ locus in preadipocytes. Such a mechanism likely plays an important role in repressing PPARγ expression and adipogenesis.

G9a‐mediated H3K9me2 represses not only the basal‐level expression of PPARγ but also the induction of PPARγ. Removal of H3K9me2 by G9a deletion increases H3K9ac and chromatin opening, which facilitate binding of upstream adipogenic transcription factor C/EBPβ to the proximal PPARγ2 promoter to promote PPARγ2 expression. These results correlated well with the recent observations that active acetylation mark, chromatin opening and C/EBPβ recruitment are critical for PPARγ2 induction in the early phase of adipogenesis (Steger et al, 2010; Siersbaek et al, 2011). A similar mechanism may work on the PPARγ1 promoter because of the increased chromatin opening on both PPARγ1 and PPARγ2 promoters and the markedly enhanced induction of both PPARγ1 and PPARγ2 during adipogenesis of G9a−/− preadipocytes, although it is presently unclear which upstream adipogenic transcription factor directly activates PPARγ1 promoter during adipogenesis.

Maintaining Wnt10a expression by G9a in preadipocytes

Although Wnt10a expression is repressed by H3K27me3 in preadipocytes (Wang et al, 2010), it is detectable and functional. It has been shown that overexpression of Wnt10a inhibits adipogenesis while knockdown of Wnt10a in preadipocytes promotes adipogenesis (Cawthorn et al, 2012). Our microarray and qRT–PCR data show that Wnt10a expression is detectable in preadipocytes but decreases after deletion of G9a (Supplementary Figure S5A and B).

Several studies have shown that in addition to gene repression through its H3K9 methyltransferase activity, G9a also promotes gene activation independent of its enzymatic activity (Lee et al, 2006; Chaturvedi et al, 2009). In preadipocytes, G9a maintains Wnt10a expression independent of its HMT activity. Consistently, deletion of G9a in preadipocytes decreases Wnt10a expression while inhibiting G9a enzymatic activity has no effect. Wnt10a expression decreases during adipogenesis (Cawthorn et al, 2012), which correlates well with the decrease in G9a protein level during adipogenesis. G9a has been shown to cooperate with transcription co‐activators GRIP1, CARM1 and p300 (Lee et al, 2006). Whether G9a cooperates with these co‐activators to promote Wnt10a expression in preadipocytes remains to be investigated. Nonetheless, the decreased expression of Wnt10a and other Wnts in G9a−/− preadipocytes, which reduces cytosolic β‐catenin protein level and attenuates Wnt signalling (Figure 6H and I), would synergize with the increased expression of PPARγ to promote adipogenesis.

Repression of adipogenesis by G9a and H3K9me2

During adipogenesis, G9a protein level decreases markedly whereas G9a mRNA level decreases about 40% (Figure 3C and D), suggesting that G9a protein and G9a mRNA are differentially regulated and that G9a is mainly regulated at the protein level during adipogenesis. A recent paper shows that DNA damage signalling triggers degradation of HMTs G9a/GLP through APC/C in senescent cells and causes a global decrease in H3K9me2 (Takahashi et al, 2012). Whether a similar mechanism is employed in the downregulation of G9a protein during adipogenesis remains to be determined. While H3K9me2 is largely invariant between ES cells and derived neurons (Lienert et al, 2011), H3K9me2 decreases markedly during adipogenesis, not only on PPARγ locus but also globally. This is due to, at least in part, the global decrease in H3K9 di‐methyltransferase G9a protein.

Our data do not exclude the involvement of demethylases in removal of H3K9me2 on PPARγ locus and induction of PPARγ especially in the early phase of adipogenesis. Consistent with this possibility, a recent paper reported that knockdown of H3K4/K9 demethylase LSD1 in 3T3‐L1 preadipocytes leads to increased H3K9me2 on C/EBPα promoter, decreased C/EBPα expression in preadipocytes and impaired adipogenesis (Musri et al, 2010), although it was unclear whether LSD1 regulates H3K9me2 on PPARγ promoter. Our study also does not rule out the possibility that G9a and/or H3K9 methylation may regulate expression of PPARγ target genes important for adipogenesis. Consistent with this possibility, SetDB1, the enzyme that performs H3K9me3, has been shown to methylate H3K9 to repress PPARγ target gene activation (Takada et al, 2007).

In addition to H3K9me2, G9a has been shown to mediate H3K27me2 (Tachibana et al, 2001). We found that consistent with a previous report (Chaturvedi et al, 2009), deletion of G9a results in ∼2‐fold decrease in the high H3K27me2 level on Ey‐globin promoter. However, H3K27me2 level is low on the PPARγ promoter and decreases very mildly after deletion of G9a (Supplementary Figure S5D). Unlike H3K9me2, which decreases dramatically on PPARγ promoter after adipogenesis (Figure 3B), the low H3K27me2 level on PPARγ promoter only decreases slightly after adipogenesis (Supplementary Figure S5D). These results suggest that G9a‐mediated H3K9me2, but not H3K27me2, plays a major role in repressing PPARγ expression and adipogenesis.

Increase of adipose tissue weight in G9a KO mice

By comparing PPARγ and aP2 expression patterns during adipogenesis of white and brown preadipocytes, we show that aP2 expression is markedly induced well before PPARγ expression reaches the maximal level (Supplementary Figure S6). Consistently, data from ex vivo experiments show that aP2‐Cre starts to delete G9a allele before PPARγ expression reaches the maximal level during adipogenesis (Figure 8B and C). The increased expression of PPARγ and the decreased expression of Wnt10a were also found in the adipose tissue of G9a KO mice (Figure 9H). These results indicate that aP2‐Cre‐mediated deletion of G9a promotes PPARγ expression and adipogenesis. Increased adipogenesis has been suggested to contribute to adipose tissue expansion and obesity (Spiegelman and Flier, 1996; Cristancho and Lazar, 2011; Sun et al, 2011). The enhanced adipogenesis in G9a KO cells likely contributes to the enhanced adipose development and increased adipose tissue weight in G9a KO mice. Importantly, the increased adipose tissue development and tissue weight observed in G9a KO mice is fundamentally different from the high fat diet‐induced obesity.

Other mechanisms likely contribute to the phenotype in G9a KO mice. Cell senescence has been linked to adipocyte size and adipose tissue inflammation (Minamino et al, 2009). Consistent with our observation that G9a deletion leads to senescence in primary cells (Supplementary Figure S3), we observed moderate increases in cell senescence markers in the WATs of a subset of G9a KO mice (Supplementary Figure S7G and H). In addition, G9a KO mice show trend of increased food intake (Supplementary Figure S7E, P=0.056). These results suggest that in addition to enhanced adipogenesis, cell senescence and increased food intake may also contribute to the increased adipose tissue weight in G9a KO mice. Thus, G9a deletion leads to alterations in multiple factors/pathways in vivo, which collectively contribute to the phenotype observed in G9a KO mice.

We previously show that the histone H3K4 methylation regulator PTIP is required for PPARγ and C/EBPα induction and adipogenesis (Cho et al, 2009), and that histone H3K27 methyltransferase Ezh2 uses its enzymatic activity to directly and constitutively repress Wnt genes to facilitate adipogenesis (Wang et al, 2010). Our current study indicates that H3K9 methyltransferase G9a represses adipogenesis by repressing PPARγ expression and facilitating Wnt10a expression. Together, these data suggest that site‐specific HMTs control the expression of master positive and negative regulators of adipogenesis.

Materials and methods

Plasmids and antibodies

Retroviral plasmids MSCVhygro‐Cre and WZLneo‐Cre have been described (Wang et al, 2010). The SV40T‐expressing retroviral plasmid pBabepuro‐large T was from Addgene (#14088). Full‐length (1210aa) or truncated (1–1048aa) human G9a (also known as EHMT2) cDNAs with N‐terminal FLAG tag were amplified by PCR from MGC clone BC020970 to add the missing N‐terminal 14aa and were cloned into MSCVhygro to generate MSCVhygro‐F‐G9a and MSCVhygro‐F‐G9aΔSET, respectively. The lentiviral shRNA plasmid pLKO.1 targeting G9a (clone ID TRCN0000054545) and shRNA control plasmid were purchased from Sigma. All plasmids were confirmed by DNA sequencing.

Mouse IgG (sc‐2025), anti‐C/EBPα (sc‐61), anti‐C/EBPβ (sc‐150x), anti‐PPARγ (sc‐7273) and anti‐p85α subunit of PI3‐kinase (sc‐1637) antibodies were from Santa Cruz. Rabbit IgG (I‐5006) and anti‐FLAG (F3165) were from Sigma. Anti‐RNA Pol II (Ab5408) and H3K9me1 (ab8896) were from Abcam. Anti‐G9a for ChIP was kindly provided by Yoshihiro Nakatani (Harvard Medical School). Anti‐G9a for western blot (09‐071) and anti‐GAPDH (mAb374) were from Millipore. Anti‐H3K4me3 (07‐473), anti‐H3K9me2 (17‐648) and anti‐H3K27me3 (07‐449) for ChIP and ChIP‐Seq were from Millipore. Anti‐H3K27me2 (#9728) was from Cell Signaling. Other histone methylation and acetylation antibodies have been described (Jin et al, 2011). All chemicals were from Sigma unless indicated.

Isolation of primary preadipocytes, immortalization, virus infection and adipogenesis assay

Primary brown preadipocytes were cultured in DMEM plus 20% fetal bovine serum (FBS). Immortalized brown preadipocytes and all other cells were routinely cultured in DMEM plus 10% FBS. Primary white preadipocytes were isolated as described (Cho et al, 2009). Primary brown preadipocytes were isolated from interscapular BATs of newborn G9aflox/flox pups and immortalized using retroviral plasmid pBabepuro‐large T as described (Wang et al, 2010). Retroviral infection of preadipocytes was done as described (Wang et al, 2010). Infection of primary MEFs and preadipocytes with adenoviruses expressing Cre and GFP (Ad5CMV‐Cre‐GFP) or GFP alone (Ad5CMV‐GFP) was performed at 50 m.o.i. as described (Cho et al, 2009).

Adipogenesis of primary white preadipocytes and immortalized white preadipocyte cell line 3T3‐L1 was carried out as described (Wang et al, 2010). For adipogenesis of brown preadipocytes, cells were plated at a density of 5 × 105 per 10 cm dish in differentiation medium (DMEM plus 10% FBS, 0.1 μM insulin and 1 nM T3) 4 days before induction of adipogenesis. At day 0, cells were treated with differentiation medium supplemented with inducing reagents 0.5 mM IBMX, 2 μg/ml dexamethasone, and 0.125 mM indomethacin (standard induction condition) or with 1/5 of inducing reagents (suboptimal condition). Two days later, cells were changed to the differentiation medium alone. The medium was replenished at 2‐day intervals. At days 6–8 post induction, fully differentiated cells were either stained with Oil Red O or subjected to qRT–PCR of gene expression or western blot analysis.

ChIP‐Seq and RNA‐Seq

Two days after 3T3‐L1 preadipocytes reached confluence (day 0), cells were treated with 1% formaldehyde for 10 min at room temperature. ChIP was performed by following a protocol from R Myers’ laboratory ( http://www.hudsonalpha.org/myers-lab/protocols). The sequencing libraries were constructed with ChIP‐Seq DNA Sample Prep kit (Illumina). RNA‐Seq libraries were prepared as described (Wei et al, 2011). Both ChIP‐Seq and RNA‐Seq libraries were sequenced on Illumina HiSeq 2000 system. The ChIP‐enriched regions were identified using SICER (Zang et al, 2009), an algorithm designed to capture domains of diffuse signals. The ChIP‐Seq and RNA‐Seq raw data sets were deposited in GEO database (accession no. GSE41455). GO analysis of H3K9me2‐enriched genes was done using the FunNet program (Transcriptional Networks Analysis) ( www.funnet.info). The details of the bioinformatic data analysis are described in Supplementary data.

Western blot, qRT–PCR, microarray and ChIP

Western blot and qRT–PCR were done as described (Cho et al, 2009). The cytosolic fraction of β‐catenin was prepared as described (Wang et al, 2010). Taqman probes for qRT–PCR were from Applied Biosystems: PPARγ (Mm00440945_m1), C/EBPα (Mm00514283_s1), Wnt1 (Mm01300555_g1), Wnt6 (Mm00437351_m1), Wnt10a (Mm00437325_m1) and Wnt10b (Mm00442104_m1). Data are presented as means±s.d. Microarray analysis in SV40T‐immortalized G9aflox/flox brown preadipocytes was performed in duplicate on Mouse Genome 430 2.0 Array (Affymetrix) as described (Cho et al, 2009). Microarray data are deposited in NCBI GEO database (accession no. GSE41456). ChIP was performed as described (Wang et al, 2010). PCR quantitation of precipitated genomic DNA relative to inputs was performed in triplicates using Taqman or SYBR Green kits (Applied Biosystems). The sequences of Taqman and SYBR Green primers are listed in Supplementary Tables S2 and S3.

Generation of adipose tissue‐specific G9a KO mice

Mice carrying two floxed G9a alleles (G9aflox/flox) (Sampath et al, 2007) were crossed with an aP2‐Cre transgenic mice line (He et al, 2003). The progeny was intercrossed to generate G9aflox/flox mice carrying aP2‐Cre transgene (G9aflox/flox; aP2‐Cre), which were used as adipose‐specific G9a KO mice. Other littermates, G9aflox/flox and G9aflox/+, were used as control (Con). Mice were analysed after weaning. No statistically significant differences in the body and tissue weights were found among the control mice. Genotyping of G9aflox/flox mice was described (Sampath et al, 2007). Mice carrying aP2‐Cre transgene were detected by PCR using primers 5′‐CCTGTTTTGCACGTTCACCG‐3′ and 5′‐ATGCTTCTGTCCGTTTGCCG‐3′ and the PCR product was 250 bp. The efficiency of aP2‐Cre‐mediated deletion of G9a gene in adipose tissues of KO mice was measured by western blot or quantitative PCR of genomic DNA using primers specific for the floxed exon 24 of G9a gene, and a Taqman probe specific for the GAPDH gene as internal control. After normalizing with GAPDH allele, the residual G9a allele in KO mice (G9aflox/flox; aP2Cre) was compared with that in the control mice. All mouse work was approved by the Animal Care and Use Committee of NIDDK, NIH.

Body composition, histology and blood chemistry

Body composition was measured in non‐anaesthetized mice using the Bruker Minispec NMR analyzer (Bruker Optics). For RNA isolation, the adipose tissues dissected from mice were put into Trizol followed by homogenization and preparation. Dissected adipose tissues were directly fixed in 10% formalin and embedded in paraffin. The sliced 5 μm sections were stained with hematoxylin and eosin and examined under Nikon Eclipse 80i microscope. β‐Galactosidase staining of adipose tissue was performed using the Senescence Cells Histochemical Staining Kit (Sigma CS0030) except the fixation time was increased to 40 min and samples were stained for 3–4 h. Blood serum chemistry tests were done by NIDDK Mouse Metabolism Core following standard procedures.

Conflict of Interest

The authors declare that they have no conflict of interest.

Supplementary Information

Supplementary Information [emboj2012306-sup-0001.doc]

Acknowledgements

We thank Alexander Tarakhovsky for the generous gift of G9aflox/flox mice; Yoshihiro Nakatani for ChIP grade G9a antibody; Harold Smith and NIDDK Genomics Core for sequencing; Oksana Gavrilova and NIDDK Mouse Metabolism Core for technical support on mouse analysis; Cuiying Xiao for help on histology; Kairong Cui, Kambiz Mousavi, Vittorio Sartorelli and Keji Zhao for help on ChIP‐Seq. This work was supported by the Intramural Research Program of the NIDDK, NIH to KG.

Author contributions: KG conceived research; LW and KG designed research; LW, JEL and AB performed research; LW and KG analysed the data; SX, SG and WP analysed the ChIP‐seq, RNA‐Seq and microarray data; LW and KG wrote the paper and all authors reviewed the paper.

References

View Abstract